The Genetic Code Of Any Organisms Comprises Of Three Nucleotides, Also Known


1. The genetic code of any organisms comprises of  three nucleotides, also known as codon. Many gene-finding programs rely  on translating a piece of DNA sequence in all possible reading frames  and looking for the longest non-interrupted region of translation.  Please develop a Java program to read in a piece of DNA sequence from a  sequence file (hwk3.seq) (alternatively you can use the getRandomSeq(long) method of the RandomSeq  class to generate a piece of DNA sequence, see week#4 conference), and  then print out all the codons in three forward reading frames. Design a  method called codon() that can be used to find  all the codons from three reading frames. The method will take in an  argument, the reading frame (1, 2, or 3), and return an array or  ArrayList with all the codons. All the codons should have three  nucleotides, please discard the last one if it does not have three  nucleotides. Below is a sample output of the program: (5 points) 

Please enter the file name contains the DNA sequence: 

hwk3.seq 

The DNA sequence is: 

TCAGCGAGATGGGAAAGATCACCTTCTTCGAGGACCGAGGCTTCCAGGGC 

Reading frame #1 codons are: 

TCA GCG AGA TGG GAA AGA TCA CCT TCT TCG AGG ACC GAG GCT TCC AGG 

Reading frame #2 codons are: 

CAG CGA GAT GGG AAA GAT CAC CTT CTT CGA GGA CCG AGG CTT CCA GGG 

Reading frame #3 codons are: 

AGC GAG ATG GGA AAG ATC ACC TTC TTC GAG GAC CGA GGC TTC CAG GGC

hwk3.seq

AGCGAGATGGGAAAGATCACCTTCTTCGAGGACCGAGGCTTCCAGGGC
find the cost of your paper

Asian American 3

I need support with this Asian Studies question so I can learn better. Write a review of the reading Marcus and Chen Inside Outside Chinatown Requirements: 250+   |   .doc fileATTACHMENTSmarcus_and_chen_inside_outside_chinatown.pdf

Environmental Science Question

m trying to learn for my Environmental Science class and I’m stuck. Can you help? Helpful Video on a shark field study: Turks & Caicos Islands: Field Research on Sharks (Links….

What is the command for it?

I’m working on a linux question and need a sample draft to help me understand better. What is the command for this, one line is all I need to solve….